View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9723_low_15 (Length: 299)
Name: NF9723_low_15
Description: NF9723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9723_low_15 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 284
Target Start/End: Original strand, 21795588 - 21795871
Alignment:
| Q |
1 |
tggtttctgaaatctcttttcacgtcgatcacaagagccccatccatctgagaaccttccacctctggtgtagcaaacaaaatcaatggaaaattcagat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| ||| ||||||||||||||||||||| || ||||||| |
|
|
| T |
21795588 |
tggtttctgaaatctcttttcacgtcgatcacaagagccccatccatctgagaacctgccacccctgttgtagcaaacaaaatcaatggcaacttcagat |
21795687 |
T |
 |
| Q |
101 |
tattgtggtgcgaatagagatcatttcgatgaaaagttaataagcgagaaacatactgcatgtgtgcacgaatcacaaactcggcacgctgaacattgcg |
200 |
Q |
| |
|
||| |||||| ||| | ||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21795688 |
tatagtggtgagaaaaaagatcatttgaatgaaaagttaataaacgagaaacatactgcatgtgtgcacgaatcacaaactcggcacgctgaacattgcg |
21795787 |
T |
 |
| Q |
201 |
atccccatcaaactcaatattcttgtctctaatttcataagaaatattgaagtaacaagaaatctttctccagcctataagaaa |
284 |
Q |
| |
|
||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21795788 |
atctccatcaaactcaatactcttgtctctaatttcataagaaatattgaagtaacaagaaatctttctccagcctataagaaa |
21795871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University