View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9723_low_18 (Length: 260)
Name: NF9723_low_18
Description: NF9723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9723_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 17 - 243
Target Start/End: Original strand, 3594370 - 3594603
Alignment:
| Q |
17 |
tcagattaggtctcaaattttatatttctttaaattattatttctatggttttattcctctttttgtcctcactaggaccgctagtc--------gtgca |
108 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| | ||||| |
|
|
| T |
3594370 |
tcagattaggtctcaaattt-atatttctttaaattattattactatggttttattcctctttttttcctcactaggaccgctagccatttgtgtgtgca |
3594468 |
T |
 |
| Q |
109 |
agaggtgaaataaccataaaataagattatggtcatgactatagaacatttgagcttataataaagtttaattatttacatattgaggtttttgtcttga |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
3594469 |
agaggtgaaataaccataaaataagattatggtcatgactatagaacatatgagcttataataaagtttaattatttacatattgaggtttttatcttgg |
3594568 |
T |
 |
| Q |
209 |
ctcctaaactgctttacaggtccgtaacagtaatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3594569 |
ctcctaaactgctttacaggtccgtaacagtaatt |
3594603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University