View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9723_low_26 (Length: 229)
Name: NF9723_low_26
Description: NF9723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9723_low_26 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 7 - 229
Target Start/End: Complemental strand, 42748953 - 42748720
Alignment:
| Q |
7 |
tgtggcattaatgaactcatcataaagcttgacacgtgagaactgagaaaacataaactcgattgaaagaaagtttgtgccaattgggttt-----gtga |
101 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || | ||| |
|
|
| T |
42748953 |
tgtggcattaatgaactcatcataaagcttgacacgtgagaactgagaaaacataaactcgattgaaagaaagtttgtgccaatcttgtctcactagtgg |
42748854 |
T |
 |
| Q |
102 |
---tgtgttggcttgacaggagtagtagtagtagta---atgcaatggttcattaaatgtgcacatgtaactgtccacgcaatataaaatatgacttcaa |
195 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
42748853 |
gtttgtgttggcttgacaggagtagtagtagtagtagtaatgcaatggttcattaaatgtgcacatgtaactgtccacgcattataaaatatgacttcaa |
42748754 |
T |
 |
| Q |
196 |
aactttcactttcagccaccaaattcatattctt |
229 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
42748753 |
aactttcactttcagccaccaaattcatattctt |
42748720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University