View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9723_low_28 (Length: 227)
Name: NF9723_low_28
Description: NF9723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9723_low_28 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 18 - 208
Target Start/End: Complemental strand, 16310061 - 16309871
Alignment:
| Q |
18 |
aggttcaaacccgaatcctgcaaataacaatgcatgtctctaccaatatgctcacggggactcttctaaaacttttctaatgacctcaatatcattccaa |
117 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16310061 |
aggttcaaatccaaatcctgcaaataacaatgcatgtctctaccaatatgctcacggggactcttctaaaacttttctaatgacctcaatatcattccaa |
16309962 |
T |
 |
| Q |
118 |
atgtatgtatattgtgacgcatatttaattaattaatacaattattttttatacatgtatccggtaatatattgccacgtcaatactcata |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16309961 |
atgtatgtatattgtgacgcatatttaattaattaatacaattattttttatacatgtatccggtaatatattgccacgtcaatactcata |
16309871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 34 - 78
Target Start/End: Complemental strand, 10602049 - 10602005
Alignment:
| Q |
34 |
cctgcaaataacaatgcatgtctctaccaatatgctcacggggac |
78 |
Q |
| |
|
|||||| |||||||||||||||||| |||| |||||||| ||||| |
|
|
| T |
10602049 |
cctgcatataacaatgcatgtctctgccaacatgctcacagggac |
10602005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University