View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9723_low_31 (Length: 208)
Name: NF9723_low_31
Description: NF9723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9723_low_31 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 149; Significance: 7e-79; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 19 - 167
Target Start/End: Original strand, 29984295 - 29984443
Alignment:
| Q |
19 |
gcaatgagtcttgtaaaagcgaccaccaaacatatctgtacaattaataagggaagtgcataatccatgggattttcatgttgaaatgccccattagaag |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29984295 |
gcaatgagtcttgtaaaagcgaccaccaaacatatctgtacaattaataagggaagtgcataatccatgggattttcatgttgaaatgccccattagaag |
29984394 |
T |
|
| Q |
119 |
tggccttcattggtggtggacatgttgaatcaggggtagccattttcaa |
167 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29984395 |
tggccttcattggtggtggacatgttgaatcaggggtagccattttcaa |
29984443 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 43 - 143
Target Start/End: Complemental strand, 51402546 - 51402446
Alignment:
| Q |
43 |
accaaacatatctgtacaattaataagggaagtgcataatccatgggattttcatgttgaaatgccccattagaagtggccttcattggtggtggacatg |
142 |
Q |
| |
|
|||| ||||||||| | ||| || || |||||||||||||| | |||||||| ||||| || || |||||||| ||||| ||||| |||| ||||||| |
|
|
| T |
51402546 |
accacacatatctgaagaatcaacaacggaagtgcataatcgagaggattttcgtgttggaaagcaccattagacgtggctttcatcggtgcaggacatg |
51402447 |
T |
|
| Q |
143 |
t |
143 |
Q |
| |
|
| |
|
|
| T |
51402446 |
t |
51402446 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University