View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9723_low_33 (Length: 205)
Name: NF9723_low_33
Description: NF9723
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9723_low_33 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 165; Significance: 2e-88; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 165; E-Value: 2e-88
Query Start/End: Original strand, 15 - 187
Target Start/End: Original strand, 7451153 - 7451325
Alignment:
| Q |
15 |
gcacgttggagtgattggttcatatttcgtgggggtgtgtgagccactctagtctctcaacctcgaagttagagctagacagtgatgaacaaattaagct |
114 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451153 |
gcactttggagtgattggttcatatttcgtgggggtgtgtgagccactctagtctctcaacctcgaagttagagctagacagtgatgaacaaattaagct |
7451252 |
T |
|
| Q |
115 |
aatgcccgaattgtggcgcaatttaggggttgttgaaaactagagctataggtgaagcataaagaaggaaagg |
187 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451253 |
aatgccccaattgtggcgcaatttaggggttgttgaaaactagagctataggtgaagcataaagaaggaaagg |
7451325 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 20 - 91
Target Start/End: Original strand, 7437769 - 7437839
Alignment:
| Q |
20 |
ttggagtgattggttcatatttcgtgggggtgtgtgagccactctagtctctcaacctcgaagttagagcta |
91 |
Q |
| |
|
||||| ||||||||| |||||||||||| |||||||||||||||| || |||| ||| ||||||||||||| |
|
|
| T |
7437769 |
ttggattgattggtttgtatttcgtgggg-tgtgtgagccactctactccctcatccttgaagttagagcta |
7437839 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University