View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9724_low_1 (Length: 326)
Name: NF9724_low_1
Description: NF9724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9724_low_1 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 178; Significance: 5e-96; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 178; E-Value: 5e-96
Query Start/End: Original strand, 92 - 318
Target Start/End: Original strand, 43072192 - 43072417
Alignment:
| Q |
92 |
ctgaaaatgacctaaacaactctaattgcagttaactactattcgctctttttgtggcagcaatcagctgccgttccaaatatacacatgtaaggtnnnn |
191 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||| ||||||||||| | ||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
43072192 |
ctgaaaatgacctaaacaactctaactgcagttaactactgttcgctctttt-gcggcagcaattagctgccgttccaaatatacacatgtaaggtaaaa |
43072290 |
T |
 |
| Q |
192 |
nnntccaacgacacttaatgccttagagcatgacaattctagaacaaccttttctctctgggtaattgggttaaatgaagaaggatttttccagctatgc |
291 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43072291 |
aaatccaatgacacttaatgccttagagcatgacaattctagaacaaccttttctctctgggtaattgggttaaatgaagaaggatttttccagctatgc |
43072390 |
T |
 |
| Q |
292 |
aggcatgttaatactgattcctttgct |
318 |
Q |
| |
|
||||||||||||||||||||||||||| |
|
|
| T |
43072391 |
aggcatgttaatactgattcctttgct |
43072417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 42; Significance: 0.000000000000008; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 42; E-Value: 0.000000000000008
Query Start/End: Original strand, 269 - 318
Target Start/End: Original strand, 40299766 - 40299815
Alignment:
| Q |
269 |
aagaaggatttttccagctatgcaggcatgttaatactgattcctttgct |
318 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
40299766 |
aagaatgatttttccagctacgcaggcatgttaatactgattcctttgct |
40299815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University