View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9724_low_2 (Length: 279)
Name: NF9724_low_2
Description: NF9724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9724_low_2 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 236; Significance: 1e-130; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 236; E-Value: 1e-130
Query Start/End: Original strand, 15 - 275
Target Start/End: Original strand, 3713324 - 3713580
Alignment:
| Q |
15 |
aggttttgtatgggatagaaggggatctttaagagaacatgcaggtgtttggaaagatgaaccttgaaacgaagctgaagatatcaagggtccacatttg |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3713324 |
aggttttgtatgggatagaaggggatctttaagagaacatgcaggtgtttggaaagatgaaccttgaaacgaagctgaagatatcaagggtccacatttg |
3713423 |
T |
|
| Q |
115 |
tctccccaacccgtattttcagatcatttttaaacactagggacatctcattgaccatccctaccataagggatatactataactgaaccaactgatacg |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
3713424 |
tctccccaacccgtattttcagatcatttttaaacactagggacatctcattgaccatccctaccataagggatatactataactgaaccaactgatagg |
3713523 |
T |
|
| Q |
215 |
gaattaagattttcagcaaattagcatcaagtatatatgatctgcaaaattcatctctctc |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||| |||| |
|
|
| T |
3713524 |
gaattaagattttcagcaaattagcatcaag----tatgatctgcaaaattcatctgtctc |
3713580 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University