View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9724_low_5 (Length: 239)
Name: NF9724_low_5
Description: NF9724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9724_low_5 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 215; Significance: 1e-118; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 1 - 223
Target Start/End: Original strand, 38266123 - 38266345
Alignment:
| Q |
1 |
gtgaatacatttgaaagtattgattcttttgtgtgctatggtcttctttctatgcttcctctgttgatagtttcttcatggttatcattgtagtcttgca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
38266123 |
gtgaatacatttgaaagtattgattcttttgtgtgctatggtcttctttctatgcttcctctgttgatagtttcttcatggctatcattgtagtcttgca |
38266222 |
T |
 |
| Q |
101 |
atgcaactttagttggtagtggattttatgatctttattgtttgttatctttacaactttagtactggattatcttaatagtggaatgcagttcaaggta |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38266223 |
atgcaactttagttggtagtggattttatgatctttattgtttgttatatttacaactttagtactggattatcttaatagtggaatgcagttcaaggta |
38266322 |
T |
 |
| Q |
201 |
tgttttatttgtattgtatgttg |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
38266323 |
tgttttatttgtattgtatgttg |
38266345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 69
Target Start/End: Original strand, 16847540 - 16847608
Alignment:
| Q |
1 |
gtgaatacatttgaaagtattgattcttttgtgtgctatggtcttctttctatgcttcctctgttgata |
69 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||| |||||||| ||| |||| ||| ||||||||||||| |
|
|
| T |
16847540 |
gtgaatacttttgaaagcgttgatgcttttgtttgctatggccttgtttcaatggctcctctgttgata |
16847608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University