View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9724_low_8 (Length: 215)
Name: NF9724_low_8
Description: NF9724
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9724_low_8 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 161; Significance: 5e-86; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 161; E-Value: 5e-86
Query Start/End: Original strand, 20 - 200
Target Start/End: Original strand, 48755576 - 48755756
Alignment:
| Q |
20 |
cgtgcagtggaatcaagagataaaggtaggaaggtctgaatcttatttatttgcaggtctgaaactatttacttgtttgataaaatacaaaagttaacga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
48755576 |
cgtgcagtggaatcaagagataaaggtaggaaggtctgaatcttatctatttgcaggtctgaaactatttacttgtttgataaaatgcaaaagttaacga |
48755675 |
T |
|
| Q |
120 |
cctagaaggattcccttgtctcaccctatctgttatcgccattatgagcgattaagccttgaactgtatttgttgatgtcc |
200 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48755676 |
cctagaaggattcccttgtctccccctatctattatcgcctttatgagcgattaagccttgaactgtatttgttgatgtcc |
48755756 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 11326826 - 11326781
Alignment:
| Q |
22 |
tgcagtggaatcaagagataaaggtaggaaggtctgaatcttattt |
67 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
11326826 |
tgcagtggaatcaagagataaaggcaggaaggtcttaatcttattt |
11326781 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 22 - 67
Target Start/End: Complemental strand, 11484847 - 11484802
Alignment:
| Q |
22 |
tgcagtggaatcaagagataaaggtaggaaggtctgaatcttattt |
67 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
11484847 |
tgcagtggaatcaagagataaaggcaggaaggtcttaatcttattt |
11484802 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 27 - 117
Target Start/End: Original strand, 47800250 - 47800340
Alignment:
| Q |
27 |
tggaatcaagagataaaggtaggaaggtctgaatcttatttatttgcaggtctgaaactatttacttgtttgataaaatacaaaagttaac |
117 |
Q |
| |
|
|||||||||||||||| | || ||| ||||||| |||| | |||||||||||||| |||||| || ||||||||||| |||| |||||| |
|
|
| T |
47800250 |
tggaatcaagagataacgatatgaatgtctgaaggttatctgtttgcaggtctgaatctatttgtttatttgataaaattcaaaggttaac |
47800340 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University