View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9725_6 (Length: 366)
Name: NF9725_6
Description: NF9725
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9725_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 220; Significance: 1e-121; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 27 - 254
Target Start/End: Complemental strand, 44089137 - 44088910
Alignment:
| Q |
27 |
cttttatcattgctgttgcttctgctagtgctactactactagtatttcgtctatcttcactgaaaaatcttttgattctccattctttatctttttgtt |
126 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44089137 |
cttttatcattgctgttgcttctgctagtgctactactactagtattttgtctatcttcactgaaaaatcttttgattctccattctttatctttttgtt |
44089038 |
T |
|
| Q |
127 |
ctacctcagagccattttgtactttagtagtcttctttatccaatcaaaagaaattggaaagaacatcttcaataggaaggtttcactgtccatgctttc |
226 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44089037 |
ctacctcagagccattttgtactttagtagtcttcttcatccaatcaaaagaaattggaaagaacatcttcaataggaaggtttcactgtccatgctttc |
44088938 |
T |
|
| Q |
227 |
aactcttaacattttaccatgtctattg |
254 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
44088937 |
aactcttaacattttaccatgtctattg |
44088910 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000008
Query Start/End: Original strand, 304 - 339
Target Start/End: Complemental strand, 44088860 - 44088825
Alignment:
| Q |
304 |
gttgaggttgttgaaatttactatacacaggttctg |
339 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||| |
|
|
| T |
44088860 |
gttgaggttgttgaaatttactatacactggttctg |
44088825 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University