View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9726_high_6 (Length: 247)
Name: NF9726_high_6
Description: NF9726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9726_high_6 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 116; Significance: 4e-59; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 118 - 237
Target Start/End: Complemental strand, 39753345 - 39753226
Alignment:
| Q |
118 |
gtgacaacattcaaatagaaaactaaggggaaggaaaacaacctggcacacataaatgtaagggaaaataatcaagaacttgttcttcattgcaataatg |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
39753345 |
gtgacaacattcaaatagaaaactaaggggaaggaaaacaacctggcacgcataaatgtaagggaaaataatcaagaacttgttcttcattgcaataatg |
39753246 |
T |
|
| Q |
218 |
tttcactggtttgatgtcca |
237 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
39753245 |
tttcactggtttgatgtcca |
39753226 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 5 - 82
Target Start/End: Complemental strand, 39753454 - 39753377
Alignment:
| Q |
5 |
ccgatgaactaaataggttctcgaatacacattacaggacaagacacaaatctccaatttgaatgattcttgtgggat |
82 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| || ||||||||||||| |
|
|
| T |
39753454 |
ccgatgaactaaataggttctcgaatacacattacaggacaatacacaaatctccaatttgcataattcttgtgggat |
39753377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 167 - 237
Target Start/End: Complemental strand, 28177872 - 28177798
Alignment:
| Q |
167 |
acataaatgtaagggaaaataat----caagaacttgttcttcattgcaataatgtttcactggtttgatgtcca |
237 |
Q |
| |
|
|||||||||||||||| |||||| ||||| ||||||||||||| ||||| ||||||||||||| ||||||| |
|
|
| T |
28177872 |
acataaatgtaagggacaataatgtttcaagagcttgttcttcattataataacgtttcactggtttcatgtcca |
28177798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University