View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9726_high_7 (Length: 243)
Name: NF9726_high_7
Description: NF9726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9726_high_7 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 15 - 171
Target Start/End: Original strand, 25839881 - 25840037
Alignment:
| Q |
15 |
atgttacacataaataaaattcgtggtaaaaattttggtgcatgtttgaattgtgatagttttgatcaagaggaggcacttaagtcgtgttgtcatgtgt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
25839881 |
atgttacacataaataaaattcgtggtaaaaattttggtgcatgtttgaattctgatagttttgatcaagaggaggcacttaagtcgtgctgtcatgtgt |
25839980 |
T |
 |
| Q |
115 |
ttgtttaagaggtgttactattagacactgagttgcttcttcgtgtggttcatctta |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
25839981 |
ttgtttaagaggtgttactattagacactgagttgcttcttcgtgtggttcacctta |
25840037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University