View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9726_high_9 (Length: 202)
Name: NF9726_high_9
Description: NF9726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9726_high_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 55246727 - 55246673
Alignment:
| Q |
125 |
caatatttaaccttaaataaaataagtagatttttgtatttttacataagtaacg |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
55246727 |
caatatttaaccttaaataaaataagtagatttttgtatttttacagaagtaacg |
55246673 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 56
Target Start/End: Complemental strand, 55246837 - 55246796
Alignment:
| Q |
15 |
caaaggagactaaaatttctgacatgaaatatatattgtgga |
56 |
Q |
| |
|
||||||| |||||||||||| ||||||||||||||||||||| |
|
|
| T |
55246837 |
caaaggaaactaaaatttctcacatgaaatatatattgtgga |
55246796 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University