View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9726_low_11 (Length: 202)

Name: NF9726_low_11
Description: NF9726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9726_low_11
NF9726_low_11
[»] chr4 (2 HSPs)
chr4 (125-179)||(55246673-55246727)
chr4 (15-56)||(55246796-55246837)


Alignment Details
Target: chr4 (Bit Score: 51; Significance: 2e-20; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 51; E-Value: 2e-20
Query Start/End: Original strand, 125 - 179
Target Start/End: Complemental strand, 55246727 - 55246673
Alignment:
125 caatatttaaccttaaataaaataagtagatttttgtatttttacataagtaacg 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
55246727 caatatttaaccttaaataaaataagtagatttttgtatttttacagaagtaacg 55246673  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 15 - 56
Target Start/End: Complemental strand, 55246837 - 55246796
Alignment:
15 caaaggagactaaaatttctgacatgaaatatatattgtgga 56  Q
    ||||||| |||||||||||| |||||||||||||||||||||    
55246837 caaaggaaactaaaatttctcacatgaaatatatattgtgga 55246796  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University