View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9726_low_6 (Length: 251)
Name: NF9726_low_6
Description: NF9726
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9726_low_6 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 169; Significance: 1e-90; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 169; E-Value: 1e-90
Query Start/End: Original strand, 54 - 237
Target Start/End: Original strand, 25840199 - 25840383
Alignment:
| Q |
54 |
ggtaaaactgtatatatggtcgaataagatggagtaatgtaggatgagtgatacgggtatgtcataggaggttctctcaatgaaagcaccgattgataca |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25840199 |
ggtaaaactgtatatatggtcgaataagatggagtaatgtaggatgagtgatacgggtatgtcataggaggttctctcaatgaaagcaccgattgataca |
25840298 |
T |
|
| Q |
154 |
g-aaacaaatttgcactcttcaagtcaatgccaaaccccaaattttacgtatcaaattcctagtgagtttagcaaaattagggtc |
237 |
Q |
| |
|
| ||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25840299 |
gaaaaaaaaattgcactcttcaagtcaatgccaaaccccaaattttacgtatcaaattcctagtgagtttagcaaaattagggtc |
25840383 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 25840169 - 25840201
Alignment:
| Q |
1 |
tagaagtttgtgacaattcgttcgtgtgtgggt |
33 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
25840169 |
tagaagtttgtgacaattcgttcatgtgtgggt |
25840201 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University