View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9729_low_12 (Length: 326)
Name: NF9729_low_12
Description: NF9729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9729_low_12 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 187; Significance: 1e-101; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 187; E-Value: 1e-101
Query Start/End: Original strand, 49 - 309
Target Start/End: Original strand, 17661407 - 17661663
Alignment:
| Q |
49 |
ctccccatccttatttggataacgctctacttgcagatacatcctcaattgaactcatcccccgatttcattaaaatgtcgagcaagtgttgcattcatt |
148 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||||||||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
17661407 |
ctccccatccttattttgataacgc----cttgcagatacatccttaattgaactcatcccccggtttcattaaaatgtcgagcaagtgttgcattcatt |
17661502 |
T |
|
| Q |
149 |
tcattttcagcgataaatttgcaactaattcaatgataacaatgcgttnnnnnnncaaggctccatggtcaaccaaggctcctctctcacctcaaaacct |
248 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17661503 |
tcattttcaacgttaaatttgcaactaattcaatgataacaatgcgttaaaaaaacaagcctccatggtcaaccaaggctcctctctcacctcaaaacct |
17661602 |
T |
|
| Q |
249 |
cgagaaatgcattgttatttattgcctgtagcacaaatctttattgttgtaagtggttcgt |
309 |
Q |
| |
|
| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17661603 |
tgggaaatgcattgttatttattgtctgtagcacaaatctttattgttgtaagtggttcgt |
17661663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 61; E-Value: 4e-26
Query Start/End: Original strand, 5 - 73
Target Start/End: Original strand, 17661338 - 17661406
Alignment:
| Q |
5 |
agtttggtgttactaacatgtcgactccttgaagttgtggatttctccccatccttatttggataacgc |
73 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
17661338 |
agtttgatgttactaacatgtcgactccttgaagttgtggatttctccccatccttattttgataacgc |
17661406 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 251 - 306
Target Start/End: Original strand, 17697704 - 17697759
Alignment:
| Q |
251 |
agaaatgcattgttatttattgcctgtagcacaaatctttattgttgtaagtggtt |
306 |
Q |
| |
|
||||||||||| |||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
17697704 |
agaaatgcatttttatttattgtctgtagcaaaactctttattgttgtaagtggtt |
17697759 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University