View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9729_low_13 (Length: 319)
Name: NF9729_low_13
Description: NF9729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9729_low_13 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 249; Significance: 1e-138; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 249; E-Value: 1e-138
Query Start/End: Original strand, 38 - 306
Target Start/End: Complemental strand, 52671996 - 52671729
Alignment:
| Q |
38 |
gaaaatatgaatattcatcaatccttccttcatctttttggcaattttttaggcatattaaccgatacgtatcacttttttcaagaggaataccttttat |
137 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52671996 |
gaaaatatgaatattcatcaatccttccttcatctttttggcaattttttaggcatattaaccgatacgtatcacttttttcaagaggaataccttttat |
52671897 |
T |
|
| Q |
138 |
agatttatttccatctcaaatgtcaggtaaccatttcttgctctgttctcaattccttttctctctttgatttcccattttttagattaacttcgcaagg |
237 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
52671896 |
agatttatttccatctcaaatgtcaggtaaccatttcttgttcttttctcaattccttttctctctttggtttcccattttttagattaacttcgcaagg |
52671797 |
T |
|
| Q |
238 |
ctccaaatagcttgcagaaaatgtgtgacaataggttcacacactcacacctgttgaactaccaccaaa |
306 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52671796 |
ctcc-aatagcttgcagaaaatgtgtgacaataggttcacacactcacacctgttgaactaccaccaaa |
52671729 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University