View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9729_low_18 (Length: 240)
Name: NF9729_low_18
Description: NF9729
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9729_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 204; Significance: 1e-111; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 204; E-Value: 1e-111
Query Start/End: Original strand, 22 - 225
Target Start/End: Original strand, 45310165 - 45310368
Alignment:
| Q |
22 |
ttcgcgtgcaaggtgatcgttcagctttctacgactgtatatttcgtggttaccaagacacattgtatgtgcatgcacatcgtcaatattatcgtaactg |
121 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310165 |
ttcgcgtgcaaggtgatcgttcagctttctacgactgtatatttcgtggttaccaagacacattgtatgtgcatgcacatcgtcaatattatcgtaactg |
45310264 |
T |
|
| Q |
122 |
tgaaatctctggcacagtagacttcatatttggttactcgtcaactctaatacaagattcgaagataattttaagaatgccttatccacatcaaaataac |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45310265 |
tgaaatctctggcacagtagacttcatatttggttactcgtcaactctaatacaagattcgaagataattttaagaatgccttatccacatcaaaataac |
45310364 |
T |
|
| Q |
222 |
acga |
225 |
Q |
| |
|
|||| |
|
|
| T |
45310365 |
acga |
45310368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University