View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9730_high_23 (Length: 321)
Name: NF9730_high_23
Description: NF9730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9730_high_23 |
 | |
|
| [»] scaffold0204 (1 HSPs) |
| | |
|
Alignment Details
Target: chr3 (Bit Score: 176; Significance: 8e-95; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 176; E-Value: 8e-95
Query Start/End: Original strand, 1 - 196
Target Start/End: Complemental strand, 52363537 - 52363343
Alignment:
| Q |
1 |
gtttcatatttgatagaaaaataatatgtaaagaaccgatatacttaattgatgtcttaattaagatttcgggtgaaaaggtagtgttgaatcactttgt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| || |||||||||||||||| |
|
|
| T |
52363537 |
gtttcatatttgatagaaaaataatatgtaaagaaccgatataattaattgatgtcttaattaagatttcgggtgaaaag-tattgttgaatcactttgt |
52363439 |
T |
|
| Q |
101 |
gtggttgttgcaaaactcaaataatgatattagctgctttagattccgctcgtctcgtaatccaataatcacttatgtaaattagagcaatgataa |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
52363438 |
gtggttgttgcaaaactcaaataatgatattagctgctttagattccgctcgtctcgtaattcaataatcacttatgtaaattagagcaatgataa |
52363343 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 93; Significance: 3e-45; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 93; E-Value: 3e-45
Query Start/End: Original strand, 197 - 304
Target Start/End: Complemental strand, 31079 - 30971
Alignment:
| Q |
197 |
ctaaacacaggtttactaacgcaatatagaggacgaaccatgt-gttgcagatgtttgtgtttgaaaagtgtgttgagaaatcattcttgtgtaggttac |
295 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31079 |
ctaaacacaggtttactaacacaatatagaggacgaaccatgttgttgcagatgtttgtgtttgaaaagtgtgttgagaaatcattcttgtgtaggttag |
30980 |
T |
|
| Q |
296 |
tatgagtac |
304 |
Q |
| |
|
||||||||| |
|
|
| T |
30979 |
tatgagtac |
30971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University