View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9730_high_30 (Length: 263)
Name: NF9730_high_30
Description: NF9730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9730_high_30 |
 | |
|
| [»] chr7 (1 HSPs) |
| |
|
Alignment Details
Target: chr7 (Bit Score: 171; Significance: 6e-92; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 171; E-Value: 6e-92
Query Start/End: Original strand, 85 - 263
Target Start/End: Original strand, 25882617 - 25882795
Alignment:
| Q |
85 |
ttggtggcaattgataaaggttttagctttgaacttgatgaattgttaagagcttctgcatatgtgttagggaaaagtgggttagggattgtgtataagg |
184 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25882617 |
ttggtggcaattgataaaggttttagctttgaacttgatgaattgttaagggcttctgcatatgtgttagggaaaagtgggttagggattgtgtataagg |
25882716 |
T |
|
| Q |
185 |
tagtgcttgggaatggggtacctgtagctgtgaggagattaggggaaggtggtgaacaaaggtataaggaatttgctac |
263 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25882717 |
tagtgcttgggaatggggtacctgtagctgtgaggagattgggggaaggtggtgaacaaaggtataaggaatttgctac |
25882795 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 85 - 259
Target Start/End: Complemental strand, 4032053 - 4031879
Alignment:
| Q |
85 |
ttggtggcaattgataaaggttttagctttgaacttgatgaattgttaagagcttctgcatatgtgttagggaaaagtgggttagggattgtgtataagg |
184 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||| |||||||| | || | || || ||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
4032053 |
ttggtgacaattgacaaaggttttaggattgagcttgatgagcttttgaaggcatcagcatatgtgttagggaagagtgcattagggattgtgtataagg |
4031954 |
T |
|
| Q |
185 |
tagtgcttgggaatggggtacctgtagctgtgaggagattaggggaaggtggtgaacaaaggtataaggaatttg |
259 |
Q |
| |
|
| |||||||| |||||| | || || || ||||||||||||||||| ||||| ||| | | ||||||||| |||| |
|
|
| T |
4031953 |
tggtgcttggaaatgggatgccggtggcggtgaggagattaggggagggtggagaagagaagtataaggagtttg |
4031879 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University