View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF9730_high_39 (Length: 229)

Name: NF9730_high_39
Description: NF9730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF9730_high_39
NF9730_high_39
[»] chr7 (1 HSPs)
chr7 (185-229)||(38557801-38557845)


Alignment Details
Target: chr7 (Bit Score: 45; Significance: 9e-17; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 45; E-Value: 9e-17
Query Start/End: Original strand, 185 - 229
Target Start/End: Original strand, 38557801 - 38557845
Alignment:
185 aataaagcatatatagactgaataattgaaatcaggttgttcgta 229  Q
    |||||||||||||||||||||||||||||||||||||||||||||    
38557801 aataaagcatatatagactgaataattgaaatcaggttgttcgta 38557845  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University