View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9730_low_32 (Length: 311)
Name: NF9730_low_32
Description: NF9730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9730_low_32 |
 |  |
|
| [»] scaffold0050 (1 HSPs) |
 |  |  |
|
| [»] scaffold0280 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 136; Significance: 6e-71; HSPs: 3)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 136; E-Value: 6e-71
Query Start/End: Original strand, 107 - 306
Target Start/End: Original strand, 493210 - 493409
Alignment:
| Q |
107 |
taatgatttcctatcaatattttcctttaatgacttgatcaaacaaatannnnnnnnnatgatttgaa---cacaattaaattaattcctttttgttttg |
203 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
493210 |
taatgacttcctatcaatattttcctttaatgacttgatcaaacaaataattttttttatgatttgaagaacacaattaaattaattcctttttgttttg |
493309 |
T |
 |
| Q |
204 |
aaaaaatttcggatcttaaagatagtattaaatgctacatgtttttgttgtgtctaaaatactactagaatgaaaagattatgacacgtaatttttgtga |
303 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
493310 |
aaaaaatttcggatcttaaagattgtattaaatgctacacgtttttgttgtgtctaaaa---tactagaatgaaaagattatgacacgtaatttttgtga |
493406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 64 - 106
Target Start/End: Complemental strand, 28502371 - 28502329
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcacccc |
106 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
28502371 |
tgttctgtccagtacttactgttttgcaaaccaaacacacccc |
28502329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 64 - 106
Target Start/End: Complemental strand, 29814777 - 29814735
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcacccc |
106 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| |||||| |
|
|
| T |
29814777 |
tgttctgtccagtacttactgttttgcaaaccaaacacacccc |
29814735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000007; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000007
Query Start/End: Original strand, 64 - 103
Target Start/End: Complemental strand, 15001379 - 15001340
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcac |
103 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
15001379 |
tgttctgtccagtacttactgttttgcaaaccaaacgcac |
15001340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 105
Target Start/End: Complemental strand, 41709690 - 41709648
Alignment:
| Q |
63 |
ttgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
41709690 |
ttgttctgtccagtacttactgttttgcaaaccaaacacaccc |
41709648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 45446367 - 45446326
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
45446367 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
45446326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0050 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0050
Description:
Target: scaffold0050; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 67 - 105
Target Start/End: Original strand, 43135 - 43173
Alignment:
| Q |
67 |
tctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
43135 |
tctgtctagtacttactgttttgcaaaccaaacgcaccc |
43173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 59 - 105
Target Start/End: Original strand, 22432469 - 22432515
Alignment:
| Q |
59 |
tgtgttgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
|||| ||||||||| |||||||| |||||| |||||||||||||||| |
|
|
| T |
22432469 |
tgtgctgttctgtctagtacttactgttttacaaaccaaacgcaccc |
22432515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 548260 - 548219
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
548260 |
tgttctgtccagtacttaatgttttgcaaaccaaacacaccc |
548219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 24181793 - 24181834
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
24181793 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
24181834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 64 - 104
Target Start/End: Original strand, 37148757 - 37148797
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcacc |
104 |
Q |
| |
|
|||| |||| |||||||| |||||||||||||||||||||| |
|
|
| T |
37148757 |
tgttttgtccagtacttactgttttgcaaaccaaacgcacc |
37148797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 105
Target Start/End: Original strand, 53557966 - 53558008
Alignment:
| Q |
63 |
ttgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
53557966 |
ttgttctgtcaagtacttactgttttgcaaaccaaacacaccc |
53558008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 20609805 - 20609846
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
20609805 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
20609846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 28675703 - 28675662
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
28675703 |
tgttctgtccagtacttattgttttgcaaaccaaacacaccc |
28675662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 34026595 - 34026554
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
34026595 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
34026554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 31; Significance: 0.00000003; HSPs: 4)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 63 - 105
Target Start/End: Complemental strand, 32497828 - 32497786
Alignment:
| Q |
63 |
ttgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
32497828 |
ttgttctgtccagtacttactgttttgcaaaccaaacacaccc |
32497786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 5279012 - 5279053
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
5279012 |
tgttctgtcaagtacttactgttttgcaaaccaaacacaccc |
5279053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 33889170 - 33889129
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
33889170 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
33889129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 109
Target Start/End: Complemental strand, 34338722 - 34338677
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcacccctaa |
109 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
34338722 |
tgttctgtccagtacttgttgttttgcaaaccaaacacacccctaa |
34338677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0280 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0280
Description:
Target: scaffold0280; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 13870 - 13911
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||| ||||||||||| |
|
|
| T |
13870 |
tgttctgtccagtacttactgttttgcaaatcaaacgcaccc |
13911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 10932736 - 10932777
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
10932736 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
10932777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 16963028 - 16962987
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
16963028 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
16962987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 36769748 - 36769789
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
36769748 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
36769789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 40753086 - 40753045
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
40753086 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
40753045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 30; Significance: 0.0000001; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 21579941 - 21579900
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
21579941 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
21579900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 113
Target Start/End: Complemental strand, 24002253 - 24002204
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcacccctaatgat |
113 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||||| ||||| ||||||| |
|
|
| T |
24002253 |
tgttctgtccagtacttgctgttttgcaaaccaaacacacccttaatgat |
24002204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 66 - 103
Target Start/End: Complemental strand, 28115190 - 28115153
Alignment:
| Q |
66 |
ttctgtcgagtacttagtgttttgcaaaccaaacgcac |
103 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
28115190 |
ttctgtctagtacttactgttttgcaaaccaaacgcac |
28115153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 30; Significance: 0.0000001; HSPs: 4)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Original strand, 1351687 - 1351728
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
1351687 |
tgttctgtcaagtacttactgttttgcaaaccaaacacaccc |
1351728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 7183839 - 7183798
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
7183839 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
7183798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 64 - 105
Target Start/End: Complemental strand, 34663863 - 34663822
Alignment:
| Q |
64 |
tgttctgtcgagtacttagtgttttgcaaaccaaacgcaccc |
105 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||| ||||| |
|
|
| T |
34663863 |
tgttctgtccagtacttactgttttgcaaaccaaacacaccc |
34663822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 66 - 110
Target Start/End: Complemental strand, 39281814 - 39281770
Alignment:
| Q |
66 |
ttctgtcgagtacttagtgttttgcaaaccaaacgcacccctaat |
110 |
Q |
| |
|
||||||| |||||||| ||||||||||||||||| ||||| |||| |
|
|
| T |
39281814 |
ttctgtccagtacttactgttttgcaaaccaaacacacccttaat |
39281770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University