View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9730_low_42 (Length: 263)
Name: NF9730_low_42
Description: NF9730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9730_low_42 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 241
Target Start/End: Complemental strand, 35945799 - 35945559
Alignment:
| Q |
1 |
ttgtgtctgcagatcaagttccgctctacggtggaatatcaattcttggaaatgataccatagaaaacatgaacaatgttgcaatggcaatgaacatagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
35945799 |
ttgtgtctgcagatcaagttccgctctacggtgggatatcaattcttggaaatgataccatagaaaacatgaacaatgttgcaatggcaatgaacataac |
35945700 |
T |
 |
| Q |
101 |
atttgagctaaaatcaaaggctgacattttaggagttttgtctacattctatcagacaattggatgtccaatcactctccatgtcaaccaacttggaaaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
35945699 |
atttgagctaaaatcaaaggctgacattttaggagttttgtctacattctatcagacaattggatgtccaatcactttccatgtcaaccaacttggaaaa |
35945600 |
T |
 |
| Q |
201 |
cctcttagtttgatagattcatgcgtctacacgtaatttat |
241 |
Q |
| |
|
||||||||||||||||||||||| ||||||| ||||||||| |
|
|
| T |
35945599 |
cctcttagtttgatagattcatgtgtctacaagtaatttat |
35945559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 36 - 70
Target Start/End: Original strand, 12132845 - 12132879
Alignment:
| Q |
36 |
atatcaattcttggaaatgataccatagaaaacat |
70 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||| |
|
|
| T |
12132845 |
atatcaattcttggaaatgataacatagaaaacat |
12132879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University