View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9730_low_53 (Length: 225)
Name: NF9730_low_53
Description: NF9730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9730_low_53 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 90; Significance: 1e-43; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 19 - 120
Target Start/End: Complemental strand, 41445520 - 41445419
Alignment:
| Q |
19 |
gaaggataagggtaacagcatttttagtattgtggagaagcaactaacagaaagatgggattagtattaggtaacggattgtcttgccttcacgcgggaa |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
41445520 |
gaaggataagggtaacaacatttttagtattgtggagaagcaactaacagaaagatgggattggtattaggtaacggattgtcttgtcttcacgcgggaa |
41445421 |
T |
|
| Q |
119 |
tg |
120 |
Q |
| |
|
|| |
|
|
| T |
41445420 |
tg |
41445419 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 107 - 166
Target Start/End: Complemental strand, 41453494 - 41453436
Alignment:
| Q |
107 |
ttcacgcgggaatgacgttgtggacttctaacattttcctccttttcccactaattttgt |
166 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||| |||| ||||||||||| ||||| |
|
|
| T |
41453494 |
ttcacgcgggaatgactttgtggacttc-aacattttgctccgtttcccactaactttgt |
41453436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University