View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9730_low_54 (Length: 224)
Name: NF9730_low_54
Description: NF9730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9730_low_54 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 179; Significance: 9e-97; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 179; E-Value: 9e-97
Query Start/End: Original strand, 15 - 209
Target Start/End: Original strand, 44766782 - 44766976
Alignment:
| Q |
15 |
aagggggaggtgatattgtgggaggagcgtcgatgacgagacggggtttgtgtggttcattgggattgagaggtgaaggtgtagttagggaaggactagg |
114 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
44766782 |
aagggggaggtgatattgtaggaggagcgtcgatgacgagacggggtttgtgtggtttattgggattgagaggtgaaggtgtagttagggtaggactagg |
44766881 |
T |
 |
| Q |
115 |
gttaggattagatttagaaatggggttattggggtttgattttagggttttggagagagaaggtgaaaggggagaagtggatttggtgaagaaag |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44766882 |
gttaggattagatttagaaatggggttattagggtttgattttagggttttggagagagaaggtgaaaggggagaagtggatttggtgaagaaag |
44766976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University