View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9730_low_55 (Length: 212)
Name: NF9730_low_55
Description: NF9730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9730_low_55 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 5e-52; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 5e-52
Query Start/End: Original strand, 53 - 197
Target Start/End: Complemental strand, 32046117 - 32045967
Alignment:
| Q |
53 |
caactaccttccagtttgtacatgatattccacccttgcttggctaggatggcttggttagacgttttcaaatcaagaaattccatccctcatttcaatt |
152 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32046117 |
caactaccttccagtttatacatgatattccacccttgcttggttaggatggcttgtttagacgttttcaaatcaagaaattccatccctcatttcaatt |
32046018 |
T |
|
| Q |
153 |
tgggaagaagcaagtct------cttccacaccatccaatgaatacctttg |
197 |
Q |
| |
|
|||||||||||| ||| || ||||||||||||||||||||||||| |
|
|
| T |
32046017 |
tgggaagaagcatatctctcccactcccacaccatccaatgaatacctttg |
32045967 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University