View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9731_high_31 (Length: 236)
Name: NF9731_high_31
Description: NF9731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9731_high_31 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 88; Significance: 2e-42; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 132 - 219
Target Start/End: Original strand, 9088119 - 9088206
Alignment:
| Q |
132 |
caaggtacctcaaatattttgataacgtttggatgattaatgatcttcatagctgaaatttctctcttcagctgccaaattcaaattc |
219 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9088119 |
caaggtacctcaaatattttgataacgtttggatgattaatgatcttcatagctgaaatttctctcttcagctgccaaattcaaattc |
9088206 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 132 - 219
Target Start/End: Original strand, 9079342 - 9079429
Alignment:
| Q |
132 |
caaggtacctcaaatattttgataacgtttggatgattaatgatcttcatagctgaaatttctctcttcagctgccaaattcaaattc |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9079342 |
caaggtacctcaaatattttgataacgtttggatgattaataatcttcatagctgaaatttctctcttcagctgccaaattcaaattc |
9079429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University