View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9731_high_33 (Length: 227)
Name: NF9731_high_33
Description: NF9731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9731_high_33 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 130; Significance: 2e-67; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 130; E-Value: 2e-67
Query Start/End: Original strand, 1 - 225
Target Start/End: Original strand, 27763480 - 27763698
Alignment:
| Q |
1 |
aatcacacatattactgttgaaagaaaccgtagaaaacaaatgaatgaacatcttgctgtacttcgttcactcatgcctgaatcctatgttcaaagggtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27763480 |
aatcacacatattactgttgaaagaaaccgtagaaaacaaatgaatgaacatcttgctgtacttcgttcactcatgcctgaatcctatgttcaaagggtt |
27763579 |
T |
|
| Q |
101 |
tgttttctttcatatatatcacacnnnnnnnnnnattgtacttcatcttttgttgttgggatttttcacaaatcttaaatatggtatttcctttaatagc |
200 |
Q |
| |
|
|||||||||| |||| |||||||| |||||||||||| | |||||||| | ||||||||||||||| | | || ||||||| |||||||| |
|
|
| T |
27763580 |
tgttttcttttatat-tatcacac-----tttttattgtacttcatttattgttgttagcatttttcacaaatctctattgtgttatttcccttaatagc |
27763673 |
T |
|
| Q |
201 |
aaagattgggagatagattcttttc |
225 |
Q |
| |
|
|||||| | |||||||||||||||| |
|
|
| T |
27763674 |
aaagatggagagatagattcttttc |
27763698 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University