View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9731_low_43 (Length: 238)
Name: NF9731_low_43
Description: NF9731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9731_low_43 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 15 - 225
Target Start/End: Original strand, 4162573 - 4162783
Alignment:
| Q |
15 |
actgggttggcatagataatcatactttttgtttgcattagttgtgtcttaggttcgaatgcatgcgaacataagtttcgattatgtatgccagctcttt |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
4162573 |
actgggttggcatagataatcatactttttgtttgcattagttgtgtcttaggttcgaatacatgggaacataagtttcgattatgtatgccagctcttt |
4162672 |
T |
 |
| Q |
115 |
accttatgtatctcctttttgtttgaatatgttcgcaaatcgtgcatttgaattagacttttggttaaattacacttcgaccctttaaattattttaggt |
214 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4162673 |
accttatgtatctcctttttgtttgaatatgttcgtaaatcgtgcatttgaattagactttaggttaaattacacttcgaccctttaaattattttaggt |
4162772 |
T |
 |
| Q |
215 |
ttcactttgaa |
225 |
Q |
| |
|
||||||||||| |
|
|
| T |
4162773 |
ttcactttgaa |
4162783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University