View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9731_low_45 (Length: 228)
Name: NF9731_low_45
Description: NF9731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9731_low_45 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 9e-57; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 33 - 178
Target Start/End: Original strand, 41270829 - 41270967
Alignment:
| Q |
33 |
taaaagagggacagagaaaggaataatgtttgtcaatgtccaagaaaagcaaagtggacaattatgtattggtttagtaaatgtggcactgctgagtgca |
132 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
41270829 |
taaaagagggacagagaaaggaataatgtttgtcaatgtccaagaaaagcaaagtggacaattatgtattggtt-------tgtggcactgttgagtgca |
41270921 |
T |
 |
| Q |
133 |
aaatactataagcatacttctcattttatgacgttattgtcatttc |
178 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41270922 |
aaatactataagcatacttctcattttataacgttattgtcatttc |
41270967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University