View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9731_low_50 (Length: 209)
Name: NF9731_low_50
Description: NF9731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9731_low_50 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 18 - 194
Target Start/End: Complemental strand, 40330643 - 40330466
Alignment:
| Q |
18 |
ggtatttgatgttgtaaactattaacttgagtaacatgatcatagacnnnnnnnnn-gctaatttaaaaagcagttacaaaaatagttactattttaaaa |
116 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40330643 |
ggtatttgatgttgtaaactattaacttgagtaacatgatcatagacaaaaaaaaaagctaatttaaaaagcagttacaaaaatagttactattttaaaa |
40330544 |
T |
|
| Q |
117 |
taatcaaagacacaataactattacttgtgtaacatgatcatagacatagtatagcagccatagtaaactattgatgt |
194 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
40330543 |
taatcaaagacacattaactattacttgtgtaacatgatcatagaaatagtttagcagccatagtaaactattgatgt |
40330466 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University