View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9731_low_7 (Length: 551)
Name: NF9731_low_7
Description: NF9731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9731_low_7 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 148; Significance: 7e-78; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 148; E-Value: 7e-78
Query Start/End: Original strand, 20 - 196
Target Start/End: Complemental strand, 27764159 - 27763984
Alignment:
| Q |
20 |
tctaactccttcacaaactctatggcaccacctactattgaggcttggtcaccctataacaaaacnnnnnnnnttcatgttaattaattgaactaatagt |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
27764159 |
tctaactccttcacaaactctatggcaccacctactattgaggcttggtcaccctataacaaaacaaaaaaa-ttcatgttaattaattgaactaatagt |
27764061 |
T |
|
| Q |
120 |
tctatttagaacatgtttttaaagcatgcatgtttgttttaaaaagtttcacttatttaatacaaattgatagttat |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27764060 |
tctatttagaacatgtttttaaagcatgcatgtttgttttaaaaagtttcacttatttaatacaaattgatagttat |
27763984 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 321 - 438
Target Start/End: Complemental strand, 27763941 - 27763821
Alignment:
| Q |
321 |
taacataatttcaactgcgataatcaaagatcataatgcaaccctagatgtgagcgcgactgcgatttaaaaccttgtttat---atgtataaaatgtag |
417 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||||||||||||||||||| ||||| ||||||||||||||||||| |||||||||| || |
|
|
| T |
27763941 |
taacataatttcaactgcgacaatcaaagatcataatgcaaccctagatgtgagcacgactatgatttaaaaccttgtttatttgttgtataaaatttaa |
27763842 |
T |
|
| Q |
418 |
tcttagtttgcttctttactt |
438 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27763841 |
tcttagtttgcttctttactt |
27763821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University