View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9732_high_4 (Length: 350)
Name: NF9732_high_4
Description: NF9732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9732_high_4 |
 | |
|
| [»] scaffold0029 (1 HSPs) |
| | |
|
Alignment Details
Target: chr4 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 18 - 340
Target Start/End: Complemental strand, 35412697 - 35412375
Alignment:
| Q |
18 |
gatgataggtgtatctaccatgtgggacaccaaatgggataaaagagttgagagaaagggagctaaagcaactgagaggtgatgatggtagtgggaaagg |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
35412697 |
gatgataggtgtatctaccatgtgggacaccaaatgggataaaagagttgagagaaagggagctaaagcaactgagaggtgattatggtagtgggaaagg |
35412598 |
T |
|
| Q |
118 |
acgcatgaaatcatcatgtgacaggatttatgattacgatgtgtacaatgatttaggtgatccagacaaaggaaatgattatgcaaggccaactctaggt |
217 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
35412597 |
acgcatgaaatcatcatgggacaggatttatgagtacgatgtgtacaatgatttaggtgatccagacaaaggaaatgattatgcaaggccaactcttggt |
35412498 |
T |
|
| Q |
218 |
ggtcaagacaatcctcatcccacacgctgtcttactggccgtcctcctactaagtctggtcagtattcattgcactctgcataaatgcagaccagtatac |
317 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35412497 |
ggtcaagacaatcctcatcccacacgctgtcatactggccgtcctcctactaagtctggtcagtattcattgcactctgcataaatgcagaccagtatac |
35412398 |
T |
|
| Q |
318 |
aagtactaccaattaaagaacac |
340 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
35412397 |
aagtactaccaattaaagaacac |
35412375 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0029 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0029
Description:
Target: scaffold0029; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 283 - 330
Target Start/End: Original strand, 53310 - 53357
Alignment:
| Q |
283 |
ttcattgcactctgcataaatgcagaccagtatacaagtactaccaat |
330 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
53310 |
ttcattgcacactacataaatgcagaccagtatacaagtactaccaat |
53357 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 6371337 - 6371289
Alignment:
| Q |
140 |
aggatttatgattacgatgtgtacaatgatttaggtgatccagacaaag |
188 |
Q |
| |
|
||||| ||||| |||||||| ||||||||||| ||||| |||||||||| |
|
|
| T |
6371337 |
aggatctatgactacgatgtctacaatgatttgggtgaaccagacaaag |
6371289 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University