View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9732_low_12 (Length: 254)
Name: NF9732_low_12
Description: NF9732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9732_low_12 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 99; Significance: 6e-49; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 18 - 120
Target Start/End: Original strand, 21910407 - 21910509
Alignment:
| Q |
18 |
aaaactagtttagtcaacctatacgaatttgcatacaaaatttatttaaaacattttagtgcatcaagcattcattatagtaaacataaaaccataactt |
117 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21910407 |
aaaactagtttaatcaacctatacgaatttgcatacaaaatttatttaaaacattttagtgcatcaagcattcattatagtaaacataaaaccataactt |
21910506 |
T |
|
| Q |
118 |
aat |
120 |
Q |
| |
|
||| |
|
|
| T |
21910507 |
aat |
21910509 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 97; E-Value: 9e-48
Query Start/End: Original strand, 138 - 250
Target Start/End: Original strand, 21910498 - 21910609
Alignment:
| Q |
138 |
ccataacttaatgaattcaagtacgaatatcatgaaaccataagtcaatttcgaaggttttgacaaaacaaatccaatggtcatgttagtataacaagaa |
237 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
21910498 |
ccataacttaatgaattcaagttcgaatatcatgaa-ccataagtcaatttcgaaggttttgacaaaacaaatccaatggtcaggttagtataacaagaa |
21910596 |
T |
|
| Q |
238 |
acaacacgaaact |
250 |
Q |
| |
|
||||||||||||| |
|
|
| T |
21910597 |
acaacacgaaact |
21910609 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University