View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9732_low_14 (Length: 241)
Name: NF9732_low_14
Description: NF9732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9732_low_14 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 224
Target Start/End: Complemental strand, 55060925 - 55060700
Alignment:
| Q |
1 |
cttttggttttcgacctctggttatgggaagaagaagtaatagttctgttgtttttgcttcggaaacatgtgcacttgatttgattgaagctacttatga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
55060925 |
cttttggttttcgacctctggttatgggaagaagaagtaatagttctgttgtttttgcttcggaaacatgtgcacttgatttgattgaagctacttatga |
55060826 |
T |
 |
| Q |
101 |
aagagaggtttgtcctggtgagattgtggttgtggataaaagtggtgttcaatctcattgtcttgtttctcgtccagaaccaaa--aatgtatttttgaa |
198 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
55060825 |
aagagaggtttatcctggtgagattgtggttgtggataaaagtggtgttcaatctcattgtcttgtttctcgtccagaaccaaaacaatgtatttttgaa |
55060726 |
T |
 |
| Q |
199 |
cgtatttatttttcattgcccaattt |
224 |
Q |
| |
|
| ||||||||||| |||||||||||| |
|
|
| T |
55060725 |
catatttattttttattgcccaattt |
55060700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 52; Significance: 6e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 52; E-Value: 6e-21
Query Start/End: Original strand, 19 - 122
Target Start/End: Complemental strand, 27357091 - 27356988
Alignment:
| Q |
19 |
tggttatgggaagaagaagtaatagttctgttgtttttgcttcggaaacatgtgcacttgatttgattgaagctacttatgaaagagaggtttgtcctgg |
118 |
Q |
| |
|
|||||||||| || ||||||||| || |||||||||||||||| || || ||||| |||||||||||||||||||||||||| || || |||| ||||| |
|
|
| T |
27357091 |
tggttatggggaggagaagtaatggtgctgttgtttttgcttctgagacttgtgctcttgatttgattgaagctacttatgagagggaagttttccctgg |
27356992 |
T |
 |
| Q |
119 |
tgag |
122 |
Q |
| |
|
|||| |
|
|
| T |
27356991 |
tgag |
27356988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University