View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9732_low_15 (Length: 241)
Name: NF9732_low_15
Description: NF9732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9732_low_15 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 1 - 217
Target Start/End: Original strand, 19281445 - 19281661
Alignment:
| Q |
1 |
aatatatgggttatcttaatcattttaaggatctcaaatttctctagnnnnnnnnggataatctcaaattaattaacatgcataaatgtcaaatattaat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
19281445 |
aatatatgggttatcttaatcattttaaggatctcaaatttctctagaaaaaaaaggataatctcaaattaattaacatgcataaataccaaacattaat |
19281544 |
T |
 |
| Q |
101 |
taattaaaatgttactttgagtcatgcagttcaaactgtaattcaatggttcgatcgttaactcaatgatgcaacacccttacgaagtcgatgattgaac |
200 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||| |||||| |||||||||||||| |||| ||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
19281545 |
taattaaaatgttactttcagtcatgcggttcaacctgtaactcaatggttcgatcattaattcagtgacgcaacatccttacgaagtcgatgattgaac |
19281644 |
T |
 |
| Q |
201 |
cgaattttaaaactatg |
217 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
19281645 |
cgaattttaaaactatg |
19281661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 158 - 217
Target Start/End: Original strand, 27658997 - 27659056
Alignment:
| Q |
158 |
ttaactcaatgatgcaacacccttacgaagtcgatgattgaaccgaattttaaaactatg |
217 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||||| ||||||| ||||||||||||| |
|
|
| T |
27658997 |
ttaactcagtgattcaacacccttattcagtcgatgatcgaaccgagttttaaaactatg |
27659056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University