View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9732_low_16 (Length: 238)
Name: NF9732_low_16
Description: NF9732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9732_low_16 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 32 - 224
Target Start/End: Complemental strand, 23450717 - 23450525
Alignment:
| Q |
32 |
acagtgtaaaatttcaagagttgtcacttatctgtttagttttgggcgcctctattactaggcttagtattttgtacagtgtcgatgttataggtatggt |
131 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23450717 |
acagtgtaaaatttcaagagttgtcacttatctgtttagttttgggcgcctctattaccaggcttagtattttgtacagtgtcgatgttataggtatggt |
23450618 |
T |
 |
| Q |
132 |
ttttcctgcacatgtagaaactttgaaatgttgctgctttggtgatctagtctttgtacttcttgtcttggattaggtttgtatgaatacatt |
224 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23450617 |
ttttcctgcacatgtagaaactttgaaatgttgctgctttggtgatctagtctttgtacttcttgtcttggattaggtttgtatgaatacatt |
23450525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University