View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9732_low_17 (Length: 208)
Name: NF9732_low_17
Description: NF9732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9732_low_17 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 145; Significance: 2e-76; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 36 - 192
Target Start/End: Complemental strand, 13855240 - 13855084
Alignment:
| Q |
36 |
ttgaaacactaatatttgttttccttggttttttggcaaataccatttcttgactgtaagatcgagtaatacaacacacttctacttagagagagtaaca |
135 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13855240 |
ttgatacactaatatttgttttccttggttttttggcaaatatcatttcttgactgtaagatcgagtaatacaacacacttctacttagagagagtaaca |
13855141 |
T |
|
| Q |
136 |
ctattgatgtcacttctcaaatatcatatctttgactataaaaagacccacatgatt |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
13855140 |
ctattgatgtcacttctcaaatatcatatcattgactataaaaagacccacatgatt |
13855084 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University