View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9733_low_14 (Length: 285)
Name: NF9733_low_14
Description: NF9733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9733_low_14 |
 |  |
|
| [»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 1 - 285
Target Start/End: Complemental strand, 25702918 - 25702634
Alignment:
| Q |
1 |
aatcaatctcgttaaatggcggccattgcgactccatggcagattttttggacaaacaagataatgtaatttgtgaagggatgtccgtcgtggcggtgcc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||| |||| |
|
|
| T |
25702918 |
aatcaatctcgttaaatggcggccattgcgactccatggcagattttttggacaaacaagataatgtaatttgtgaagggatgtctatcatggcgttgcc |
25702819 |
T |
 |
| Q |
101 |
atagtccgcagtagcgtttttataattaatatggcagatttttagccttctatcatattctgcaatcaaccatccacgacattggtccaaagcatctaat |
200 |
Q |
| |
|
|| ||||||| ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| ||| | |
|
|
| T |
25702818 |
attgtccgcaatagtgtttttataaataatatggcagatttttagccttctatcatattctgcaatcaaccatccacaacattggtccaaagcacctagt |
25702719 |
T |
 |
| Q |
201 |
tatagcaaattttcttcaaatagaactatccataccttctgtcagtgatattattctgaatcctctcttattagtattatcattt |
285 |
Q |
| |
|
||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
25702718 |
tatagcaaattttctacaaatagaactatccatactttctgtcagtgatattattctgaatcctctcttattagtattctcattt |
25702634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University