View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9733_low_17 (Length: 262)
Name: NF9733_low_17
Description: NF9733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9733_low_17 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 72; Significance: 8e-33; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 155 - 254
Target Start/End: Original strand, 30565054 - 30565153
Alignment:
| Q |
155 |
ggtaaggaaataaacttggcttccggtgtcaacagagttcaattggtggccatatgtagtgtcccagaaacgaatacacctatcatcagttccacctcca |
254 |
Q |
| |
|
|||||| |||||||| |||||||| |||||||||||||||||||||||||||| |||||||| ||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
30565054 |
ggtaagaaaataaacctggcttccagtgtcaacagagttcaattggtggccatttgtagtgttccagaaacgaatacaccgatcagcagttccacctcca |
30565153 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 22 - 136
Target Start/End: Complemental strand, 22286307 - 22286193
Alignment:
| Q |
22 |
agacattgtgaagcaatggcagcagcaaaatgagctcacctatgtgaattttgaccttcaagtcgtggatctatcacgcaaaaatatcaacctttgttga |
121 |
Q |
| |
|
|||||||||||||||| ||| || ||| |||||||| |||||||||| ||||||||| ||||||||||| || |||| |||| || | ||||||| |
|
|
| T |
22286307 |
agacattgtgaagcaagggcggccgcagcatgagctcggctatgtgaatattgaccttcgagtcgtggatccattacgcgaaaaactctgcgtttgttgg |
22286208 |
T |
|
| Q |
122 |
ataggtagggcttgg |
136 |
Q |
| |
|
||||||| ||||||| |
|
|
| T |
22286207 |
ataggtaaggcttgg |
22286193 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 209 - 253
Target Start/End: Complemental strand, 18746688 - 18746644
Alignment:
| Q |
209 |
tgtagtgtcccagaaacgaatacacctatcatcagttccacctcc |
253 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||| |
|
|
| T |
18746688 |
tgtagtgttccagaaacgaatacacctatcagcagttccacctcc |
18746644 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University