View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9734_low_6 (Length: 276)
Name: NF9734_low_6
Description: NF9734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9734_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 244; Significance: 1e-135; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 244; E-Value: 1e-135
Query Start/End: Original strand, 11 - 262
Target Start/End: Original strand, 43845515 - 43845766
Alignment:
| Q |
11 |
cataggtagtggaggtgagagagaggagaagaaaatgcttttgctaatttgctttgaatatagaaaacagatattaaaatttaaaaaggttataggaaag |
110 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
43845515 |
cataggtagtggaggtgagagagaggagaagaaaatgcttttgctaatttgctttgaatatagaaaacaaatattaaaatttaaaaaagttataggaaag |
43845614 |
T |
 |
| Q |
111 |
aaaaagatggtgtgcgtggagcataagcttcttgtgttgcttttcttgttatccaaccaaaatcttagtgtggtcttaagcttaaactctaaatcccatg |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43845615 |
aaaaagatggtgtgcgtggagcataagcttcttgtgttgcttttcttgttatccaaccaaaatcttagtgtggtcttaagcttaaactctaaatcccatg |
43845714 |
T |
 |
| Q |
211 |
caaatattaaattagtcccaacttcccaacacaaaagacatgcatgtttttg |
262 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43845715 |
caaatattaaattagtcccaacttcccaacacaaaagacatgcatgtttttg |
43845766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University