View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9735_12 (Length: 320)
Name: NF9735_12
Description: NF9735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9735_12 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr1 (Bit Score: 180; Significance: 3e-97; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 180; E-Value: 3e-97
Query Start/End: Original strand, 2 - 193
Target Start/End: Original strand, 47198124 - 47198315
Alignment:
| Q |
2 |
atgaatcattttaatgcataatgcagccgaatcaatgttaaaatattaaaccaaatacatgaatttttattatgtttaattatgtacaggtcttccagca |
101 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47198124 |
atgaatcattttaatgcataatgcagtcgaatcaatgttaaaatattaaaccaaatacataaatttttattatgtttaattatgtacaggtcttccagca |
47198223 |
T |
|
| Q |
102 |
atgcaccggcatcaatgcaatcatgttctatgctccagtattgttcagcactctgggatttcacaatgatgcttcactttactcaccagtga |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
47198224 |
atgcaccggcatcaatgcaatcatgttctatgctccagtattgttcagcactctgggatttcacaatgatgcttcactttactcatcagtga |
47198315 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 89 - 193
Target Start/End: Original strand, 47185672 - 47185776
Alignment:
| Q |
89 |
aggtcttccagcaatgcaccggcatcaatgcaatcatgttctatgctccagtattgttcagcactctgggatttcacaatgatgcttcactttactcacc |
188 |
Q |
| |
|
|||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||| | |
|
|
| T |
47185672 |
aggtcttccaacaattcaccggcatcaatgcaatcatgttctatgctccagtattgttcaacactttgggatttcacaatgatgcttcactttactcatc |
47185771 |
T |
|
| Q |
189 |
agtga |
193 |
Q |
| |
|
||||| |
|
|
| T |
47185772 |
agtga |
47185776 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 97 - 185
Target Start/End: Original strand, 47212308 - 47212396
Alignment:
| Q |
97 |
cagcaatgcaccggcatcaatgcaatcatgttctatgctccagtattgttcagcactctgggatttcacaatgatgcttcactttactc |
185 |
Q |
| |
|
||||||| ||| ||||||||||| || ||||||||||||||||| |||||| ||| | |||||| | ||||||||| |||||||||| |
|
|
| T |
47212308 |
cagcaattcactggcatcaatgcgataatgttctatgctccagttctgttcaacaccttaggatttaagaatgatgctgcactttactc |
47212396 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 116; Significance: 5e-59; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 116; E-Value: 5e-59
Query Start/End: Original strand, 201 - 320
Target Start/End: Complemental strand, 50213116 - 50212997
Alignment:
| Q |
201 |
gaacctgtgcaccaccaaatccgaaccctcagcatcttcttcgtcaatgcaacacgtgccagagctagattctaacgaaatggaacgtgtggcaaaccaa |
300 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50213116 |
gaacttgtgcaccaccaaatccgaaccctcagcatcttcttcgtcaatgcaacacgtgccagagctagattctaacgaaatggaacgtgtggcaaaccaa |
50213017 |
T |
|
| Q |
301 |
acattccaaaggtacacttc |
320 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
50213016 |
acattccaaaggtacacttc |
50212997 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University