View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9736_7 (Length: 388)
Name: NF9736_7
Description: NF9736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9736_7 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 352; Significance: 0; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 352; E-Value: 0
Query Start/End: Original strand, 1 - 368
Target Start/End: Complemental strand, 6679320 - 6678953
Alignment:
| Q |
1 |
cataagcataactgtaagcagttgggcaagctttcttaaatatctctgaataatgtgtaggcgaacatgtttgtggcgtggcatgtcggccggtgcaaca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6679320 |
cataagcataactgtaagcagttgggcaagctttcttaaatatctccgaataatgtgtaggcgaacatgtttgtggcgtggcatgttggccggtgcaaca |
6679221 |
T |
|
| Q |
101 |
aaattcctccatattgaatgccaaacacgcgctcttacaagccaccaccgaacctccactgttcaccctaagctctgccggacatccaccattcaagtcc |
200 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6679220 |
aaattcctccatattgaacgccaaacacgcgctcttacaagccaccaccgaacctccactgttcaccctaagctctgccggacatccaccattcaagtcc |
6679121 |
T |
|
| Q |
201 |
gcaacacaccccgcatattgacaatcaccggtgcctcctgtagcccatacacccatgcctgcattgtaaccgtctaccaagctcacgtcgtagaagtcct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6679120 |
gcaacacaccccgcatattgacaatcaccggtgcctcctgtagcccatacacccatgcctgcattgtaaccgtctaccaagctcacgtcgtagaagtcct |
6679021 |
T |
|
| Q |
301 |
tgccgccattaccagctgatccaatagtgaattcggccaatgtcaccggtggggtacctcctccgata |
368 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6679020 |
tgccgccattaccggctgatccaatagtgaattcggccaatgtcaccggtggggtacctcctccgata |
6678953 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University