View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9736_low_3 (Length: 271)
Name: NF9736_low_3
Description: NF9736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9736_low_3 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 243; Significance: 1e-135; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 243; E-Value: 1e-135
Query Start/End: Original strand, 1 - 263
Target Start/End: Original strand, 17196441 - 17196703
Alignment:
| Q |
1 |
aacgaggttatgattaccgagccaatcataaagaacaggaacaagagatttccattgagagtacttctcatcaacagaagcttgttgttgctgctgctga |
100 |
Q |
| |
|
|||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196441 |
aacgaggttatgattagcaagccaatcataaagaacaggaacaagagatttccattgagagtacttctcatcaacagaagcttgttgttgctgctgctga |
17196540 |
T |
|
| Q |
101 |
tgaagctgttgctgttgcttttccttcttcgattctctcggtgtcttcacttgtgatggttcttctctcttgtcttccttgggtttaggtttgcgtcctc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17196541 |
tgaagctgttgctgttgcttttccttcttcgattctctcggtgacttcacttgtgatggttcttctctcttgtcttccttgggtttaggtttgcgtcctc |
17196640 |
T |
|
| Q |
201 |
ttgtctccttcttcttcacggcgccggttgagggtggtgtctccatttctcacgctctctgct |
263 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
17196641 |
ttgtctccttcttcttcacggcgccggttgagggtggtgtctccatttctcactctctgtgct |
17196703 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University