View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9737_high_31 (Length: 223)
Name: NF9737_high_31
Description: NF9737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9737_high_31 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 143; Significance: 3e-75; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 1 - 207
Target Start/End: Original strand, 39123732 - 39123921
Alignment:
| Q |
1 |
aggttacataacacaatggatgcatgcatgttttaaaaacaattggagacgggttcaatatgtcttaggcgaaaatcaagagtgaattgccaatcaattc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
39123732 |
aggttacataacacaatggatgcatgcatgtttttaaaacaattggagacgggttcaat-----------------caagagtgaattgccaatcaattc |
39123814 |
T |
 |
| Q |
101 |
tttgtttttcattcttgtcattattgttcgtaatattaagcaatttatttttacgtaaatagtcttctggaaaagtttcaacctaatcaatttctcttta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
39123815 |
tttgtttttcattcttgtcattattgttcgtaatattaagcaatttatttttacgtaaatagtcttctgaaaaagtttcaacctaatcaatttctcttta |
39123914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 12 - 127
Target Start/End: Complemental strand, 38610077 - 38609961
Alignment:
| Q |
12 |
cacaatggatgcatgcatgttttaaaaacaattggagacgggttcaatatgtcttaggcgaaaatcaagagtgaattgccaatcaattc-tttgtttttc |
110 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||| ||||||||||||| |||| ||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
38610077 |
cacaatggatgcatgcatgtttttaaaacaaccagagacgaattcaatatgtctttagcgagaatcaagagtgaattgccaatcaattcttttgtttttc |
38609978 |
T |
 |
| Q |
111 |
attcttgtcattattgt |
127 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
38609977 |
attcttgccattattgt |
38609961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 171 - 204
Target Start/End: Complemental strand, 38609959 - 38609926
Alignment:
| Q |
171 |
aaaagtttcaacctaatcaatttctctttaaaga |
204 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
38609959 |
aaaagtttcaacctaatcaatttctctttaaaga |
38609926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University