View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9737_low_19 (Length: 293)
Name: NF9737_low_19
Description: NF9737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9737_low_19 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 76; Significance: 4e-35; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 19 - 110
Target Start/End: Original strand, 2775758 - 2775849
Alignment:
| Q |
19 |
caagagctctttcgtttcaaatgtacgtactccctgtgttccaaaatgtaagcaaaaattagttaaaatttgtatcagatatatcaacttat |
110 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2775758 |
caagagctctttcgtttcaaatgtacgtattccctgtgtcccaaaatgtaaataaaaattagttaaaatttgtatcagatatatcaacttat |
2775849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 182 - 283
Target Start/End: Original strand, 2775919 - 2776019
Alignment:
| Q |
182 |
aaatctaggtatggtgctagtgttcagacctctcttcatgtgttttgttattgcatttttctcnnnnnnnngaacttggaaaaagctattggattacctt |
281 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
2775919 |
aaatctaggtatggcgctagtgttgagacctctcatcatgtgttttgttattgcatttttctc-aaaaaaagaacttggaaaaagctattggattacctt |
2776017 |
T |
 |
| Q |
282 |
tg |
283 |
Q |
| |
|
|| |
|
|
| T |
2776018 |
tg |
2776019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 83 - 118
Target Start/End: Original strand, 13210016 - 13210051
Alignment:
| Q |
83 |
aaaatttgtatcagatatatcaacttatgttgaccc |
118 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13210016 |
aaaatttgtatcagatacatcaacttatgttgaccc |
13210051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University