View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9737_low_21 (Length: 288)
Name: NF9737_low_21
Description: NF9737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9737_low_21 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 276
Target Start/End: Complemental strand, 38085249 - 38084991
Alignment:
| Q |
1 |
taattacatggtcgctatttattttgattacatggtcgttatttattcttattcagctttcnnnnnnnnnnnnaatgaaattattaagctctctaataaa |
100 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
38085249 |
taattacatggtcgctatttattatgattacatggtcgttatttattattattcagcttttttttttttttttaatgaaattattaagctctctaataaa |
38085150 |
T |
 |
| Q |
101 |
ggtgattgcgatattattgttttcattaccttgtttgttagtacattaacggaaaactgtagttgtcctttacttcaacgacttactgatgtatacatac |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38085149 |
ggtgattgcgatattattgttttcattaccttgtttgttagtacattaacggaaaactgtagttgtcctttacttcaacgactt---------------- |
38085066 |
T |
 |
| Q |
201 |
tactgcatgcgatattagttgtcacaatttgaatggagccagcatgactaaattttaaaaaagtgataactgaaat |
276 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38085065 |
-actgcatgcgatattagttgtcacaatttgaatggagccagcatgactaaattttaaaaaagtgataactgaaat |
38084991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University