View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9737_low_25 (Length: 260)
Name: NF9737_low_25
Description: NF9737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9737_low_25 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 111 - 249
Target Start/End: Original strand, 12920258 - 12920395
Alignment:
| Q |
111 |
gttactcccatacttgaacaaaatttgtgttttttattttctctgaaaaccaatcaagttcataagcttgtttagatgtggttgaaaacttcatgtttat |
210 |
Q |
| |
|
|||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920258 |
gttactcccatacttgaacaaagtttgtgtttt-tattttctctgaaaaccaatcaagttcataagcttgtttagatgtggttgaaaacttcatgtttat |
12920356 |
T |
|
| Q |
211 |
attcattttgatttttcaattgcaaacaaatgcattcat |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12920357 |
attcattttgatttttcaattgcaaacaaatgcattcat |
12920395 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University