View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF9737_low_36 (Length: 240)
Name: NF9737_low_36
Description: NF9737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF9737_low_36 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 168; Significance: 4e-90; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 1 - 224
Target Start/End: Original strand, 5035961 - 5036175
Alignment:
| Q |
1 |
ccaagtaccatgtgttttagcaaattaattatctattttaatttagacaatagaaaaaagaatagtacactatgacaagtgttactattccaagtaatcc |
100 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5035961 |
ccaagtaccatgtgctttagcaaattaattatctgttttaatttagacaatagaaaaaagaatagtacactatgacaagtgttactattcca-------- |
5036052 |
T |
|
| Q |
101 |
aagtaggcaattgttttactctccactaatccaagtaggaaagtgtttagatttaaagtgaattaatgactacatcaaaggttcagtccttttcttggtc |
200 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5036053 |
-agtaggcaaatgttttactctccactaatccaagtaggaaagtgtttaaatttaaagtgaattaatgactacatcaaaggttcagtccttttcttggtc |
5036151 |
T |
|
| Q |
201 |
aacttagtctatccaactaattgt |
224 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
5036152 |
aacttgatctatccaactaattgt |
5036175 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University